Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
chr15:95864225-95894541+ | |||
Gene | Ano6 | Organism | Human |
Genome Locus | chr15:95864225-95894541:+ | Build | hg19 |
Disease | Intestinal injury and repair | ICD-10 | Injury of unspecified intra-abdominal organ (S36.9) |
DBLink | Link to database | PMID | 29991023 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Day 3.5 post-radiation, the mice were sacrificed and their jejuna harvested and frozen at -80°C and matched controls |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CAGAGGCGAATCGACTTCAT ReverseGGGCTTCCCGTTAAATTCTT | Statistics | Fold Change : Upregulated,3.9069187 pvalue : p=0.0300941 |
Citation | |||
Lu, Q, Gong, W, Wang, J, Ji, K, Wang, Y, Xu, C, Liu, Y, He, N, Du, L, Liu, Q (2018). Identification of Circular RNAs Altered in Mouse Jejuna After Radiation. Cell. Physiol. Biochem., 47, 6:2558-2568. |